upload
Food and Agriculture Organization of the United Nations
Industri: Agriculture
Number of terms: 87409
Number of blossaries: 0
Company Profile:
Established in October 1945 with the objective of eliminating hunger and improving nutrition and standards of living by increasing agricultural productivity, FAO coordinates the efforts of governments and technical agencies in programs for developing agriculture, forestry, fisheries, and land and ...
Forhastet spiring af embryonet, før afslutningen af embryogenese.
Industry:Biotechnology
Keadaan relatif insusceptibility binatang atau tanaman untuk infeksi dengan penyakit-menghasilkan organisme atau efek berbahaya dari racun mereka.
Industry:Biotechnology
Langkah-langkah dalam produksi virus yang biasanya menyebabkan sel Lisis.
Industry:Biotechnology
Strand DNA yang disintesis secara terus menerus selama replikasi.
Industry:Biotechnology
Strand DNA yang disintesis discontinuously selama replikasi (karena sintesis DNA dapat melanjutkan hanya dalam 5´ ke arah 3´).
Industry:Biotechnology
Reproduktionsfysiologien fase af et Skovfirben dyr, mellem fosterstadiet og fødsel.
Industry:Biotechnology
Allerede forberedt løsninger af enkelte komponenter og bruges til at forberede mange forskellige typer af medier. Visse stoffer, herunder Ca og Mg sulfater og fosfater må ikke kombineres indtil faktiske mellemlang tilberedning, fordi uopløselige kombinationer er dannet og udfælde.
Industry:Biotechnology
Strand duplex DNA yang berisi urutan dasar yang sama (setelah menggantikan U T) ditemukan pada molekul mRNA yang dihasilkan dari transkripsi bahwa segmen DNA. alias rasa strand. MRNA molekul ditranskripsi dari strand lainnya, dikenal sebagai template atau antisense strand.MRNA Coding strand 5´ ATGAAAGCTTTAGTGGGCGCCCGTAT 3´ Template strand 3´ TACTTTCGAAATCACCCGCGGGCATA 5´ 5´ AUGAAAGCUUUAGUGGGCGCCCGUAU 3´
Industry:Biotechnology
Strand DNA beruntai ganda yang benar-benar ditulis. Juga dikenal sebagai antisense atau template strand.
Industry:Biotechnology
Struktur yang terbentuk ketika molekul DNA beruntai ganda yang mengandung terbalik ulangi urutan didenaturasi dan kemudian diperbolehkan untuk re-anneal pada konsentrasi rendah DNA. Ulang urutan memungkinkan pembentukan wilayah beruntai ganda dalam setiap helai terpisah molekul.
Industry:Biotechnology
© 2025 CSOFT International, Ltd.