upload
Food and Agriculture Organization of the United Nations
Industri: Agriculture
Number of terms: 87409
Number of blossaries: 0
Company Profile:
Established in October 1945 with the objective of eliminating hunger and improving nutrition and standards of living by increasing agricultural productivity, FAO coordinates the efforts of governments and technical agencies in programs for developing agriculture, forestry, fisheries, and land and ...
De bundel van DNA dat is gesynthetiseerd met tijdens replicatie (omdat DNA-synthese kan alleen in de 5´ overgaan tot 3´ richting).
Industry:Biotechnology
Het onderdeel van duplex DNA waarin dezelfde basis volgorde (na vervangen door U T) gevonden in de mRNA molecule als gevolg van de transcriptie van dat segment van DNA. aka zin strand. De mRNA molecuul is transcriptie van de andere strand, bekend als de sjabloon of antisense bundel. Codering onderdeel 5´ ATGAAAGCTTTAGTGGGCGCCCGTAT 3´ sjabloon onderdeel 3´ TACTTTCGAAATCACCCGCGGGCATA 5´ mRNA 5´ AUGAAAGCUUUAGUGGGCGCCCGUAU 3´
Industry:Biotechnology
Het onderdeel van de DNA dubbele helix die daadwerkelijk wordt omgezet. Ook bekend als het onderdeel antisense of sjabloon.
Industry:Biotechnology
Produção de um embrião de um ovo não fertilizado.
Industry:Biotechnology
Difusão das áreas de alta concentração para áreas de menor concentração de um solvente através de uma membrana diferencialmente permeável.
Industry:Biotechnology
Usados de forma intercambiável com quilobase.
Industry:Biotechnology
1. a absorção de líquidos ou vapores no Ultramicroscópicos espaços ou poros encontrada em materiais. 2. a absorção de água inicial por iniciar a germinação de sementes.
Industry:Biotechnology
De structuur gevormd wanneer een double-stranded DNA molecuul met een omgekeerde volgorde is gedenatureerd en dan mag re-anneal bij lage concentraties van DNA herhalen De herhaalde sequentie maakt de vorming van een double-stranded regio binnen elk van de afzonderlijke onderdelen van de oorspronkelijke molecule.
Industry:Biotechnology
Um grupo de crescimento reguladores de plantas (naturais ou sintéticos) que estimulam a divisão celular, dominância apical, alargamento, iniciação de raiz e floração. Uma auxina produzida naturalmente é o ácido indol-acético (IAA).
Industry:Biotechnology
A produção assexuada da prole diplóide sem a fusão de gametas. o embrião desenvolve-se por divisão mitótica, a gameta paterna ou materna, ou, no caso de plantas, por divisão mitótica de uma célula diplóide do óvulo.
Industry:Biotechnology
© 2025 CSOFT International, Ltd.